kguynn8673 kguynn8673
  • 02-11-2018
  • History
contestada

How did the Agricultural Revolution cause the population of Great Britain to increase?

Respuesta :

pshort3
pshort3 pshort3
  • 06-11-2018

i think  what your talking about is :

The Agricultural Revolution of the 18th century paved the way for the Industrial Revolution in Britain. New farming techniques and improved livestock breeding led to amplified food production. This allowed a spike in population and increased health. The new farming techniques also led to an enclosure movement.

Answer Link

Otras preguntas

the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
what are 2 points on the graph for 6x-5y=25
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
is a centimeter one tenth or one hundredth or a meter
what are 2 points on the graph for 6x-5y=25
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120